Review



fgf9 r d systems  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    R&D Systems fgf9 r d systems
    Fgf9 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Mouse+FGF-9+Protein/pm41075787-319-68-69
    Average 93 stars, based on 10 article reviews
    fgf9 r d systems - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Labeling:

    Article Title: Human Pluripotent Stem Cell-Derived Kidney Organoids with Improved Collecting Duct Maturation and Injury Modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-AQP2 Novus Biologicals Cat#NB110-74682; RRID: AB_1107363 anti-AQP2 Santa Cruz Biothechnology Cat#SC-9882; RRID: AB_2289903 Rhodamine labeled DBA Vector Labs Cat#RL-1032; RRID: AB_2336396 anti-ECAD Abcam Cat#ab11512; RRID: AB_298118 anti-WT1 Santa Cruz Biothechnology Cat#SC-7385; RRID: AB_628448 biotinylated LTL Vector Labs Cat#B-1325; RRID: AB_2336558 anti-MEIS1 Active Motif Cat#39795; RRID: AB_2750570 anti-PDGFRB Abcam Cat#ab32570; RRID: AB_777165 anti-ATP6V1B1 Santa Cruz Biothechnology Cat#SC-55544; RRID: AB_831844 anti-ATP6V1B1 Abcam Cat#ab76020; RRID: AB_1310695 anti-SLC12A1 Abcam Cat#ab171747; RRID: AB_2802126 anti-CD31 R&D Systems Cat#bba7; RRID: AB_356960 anti-NPHS1 R&D Systems Cat#AF4269; RRID: AB_2154851 anti-CK8 Abcam Cat#ab9023; RRID: AB_306948 anti-Na/K/ATPase Abcam Cat#ab76020; RRID: AB_1310695 anti-HAVCR1 R&D Systems Cat#AF1750; RRID: AB_2116561 anti-SOX9 Abcam Cat#ab185230; RRID: AB_2715497 anti-NGAL Abcam Cat#ab23477; RRID: AB_447460 anti-KRT7 Abcam Cat#ab9021; RRID: AB_306947 anti-UPK2 Novus Biologicals Cat#NBP2-33389 Secondary antibodies included FITC-, Cy3, or Cy5-conjugated Jackson ImmunoResearch Cat#711-095-152; RRID: AB_2315776, Cat#712-095-153; RRID: AB_2340652, Cat#715-165-151; RRID: AB_2315777, Cat#713-165-147; RRID: AB_2315778, Cat#016-600-084; RRID: AB_2341101, Cat#703-165-155; RRID: AB_2340363 Secondary antibodies included AlexaFlour488-, or AlexaFlour568conjugated Thermo Fisher Scientific Cat#A21206; RRID: AB_2535792, Cat#A21202; RRID: AB_141607, Cat#A11057; RRID: AB_142581 anti-HOXD11 Millipore Sigma Cat#SAB1403944; RRID: AB_10739483 anti-GATA3 R&D Systems Cat#AF2605; RRID: AB_2108571 Chemicals, Peptides, and Recombinant Proteins StemFlex Medium Thermo Fisher Scientific Cat#A3349401 Stemdiff APEL2 Medium STEMCELL Technologies Cat#05275 Protein Free Hybridoma Medium II Thermo Fisher Scientific Cat#12040077 Matrigel hESC-Qualified Matrix Corning Cat#354277 CHIR99021 Tocris Bioscience Cat#4423 FGF9 R&D Systems Cat273-F9-025/CF Heparin Millipore Sigma Cat#H4784 Activin A R&D Systems Cat#338-AC Bmp4 R&D Systems Cat#314-BP Retinoic acid Millipore Sigma Cat#R2625 LDN193189 Axon Medchem Cat#Azon1509 GDNF R&D Systems Cat#212-GD (Continued on next page) e1 Cell Reports 33, 108514, December 15, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER EGF Thermo Fisher Scientific Cat#PHG0311 Aldosterone Millipore Sigma Cat#A9477 AVP Millipore Sigma Cat#V9879 K-252a Millipore Sigma Cat#K1639 ReLeSR STEMCELL Technologies Cat#05872 0.25% Trypsin-EDTA Thermo Fisher Scientific Cat#25200-114 Antibiotic-Antimycotic Thermo Fisher Scientific Cat#15240-062 Cisplatin Millipore Sigma Cat#P4394 Forskorin Selleck Chemicals Cat#S2449 Phalloidin-FITC Millipore Sigma Cat#P5282 DAPI (4’,6’- diamidino-2-phenylindole) Thermo Fisher Scientific Cat#D1306 Critical Commercial Assays Chromium Single Cell 5¿ Library &Gel Bead Kit 10x Genomics Cat#PN-1000006 Deposited Data Kidney organoid scRNA-seq This study GEO:GSE131086 Experimental Models: Cell Lines Human iPSCs: BJFF.6 line GEiC N/A Human ESCs: H9 line GEiC N/A Oligonucleotides All qPCR oligos This study Table S3 Software and Algorithms CellRanger 10x Genomics N/A Seurat https://satijalab.org/seurat/ N/A DoubletFinder https://github.com/chris-mcginnis-ucsf/ DoubletFinder N/A Harmony https://github.com/immunogenomics/ harmony N/A Monocle2 http://cole-trapnell-lab.github.io/ monocle-release/docs/ N/A scHCL https://github.com/ggjlab/scHCL/ N/A Other Fetal human kidney scRNA-seq Hochane et al., 2019 GEO:GSE114530 Adult human kidney scRNA-seq Wu et al., 2018 GEO:GSE118184

    Recombinant:

    Article Title: Human Pluripotent Stem Cell-Derived Kidney Organoids with Improved Collecting Duct Maturation and Injury Modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-AQP2 Novus Biologicals Cat#NB110-74682; RRID: AB_1107363 anti-AQP2 Santa Cruz Biothechnology Cat#SC-9882; RRID: AB_2289903 Rhodamine labeled DBA Vector Labs Cat#RL-1032; RRID: AB_2336396 anti-ECAD Abcam Cat#ab11512; RRID: AB_298118 anti-WT1 Santa Cruz Biothechnology Cat#SC-7385; RRID: AB_628448 biotinylated LTL Vector Labs Cat#B-1325; RRID: AB_2336558 anti-MEIS1 Active Motif Cat#39795; RRID: AB_2750570 anti-PDGFRB Abcam Cat#ab32570; RRID: AB_777165 anti-ATP6V1B1 Santa Cruz Biothechnology Cat#SC-55544; RRID: AB_831844 anti-ATP6V1B1 Abcam Cat#ab76020; RRID: AB_1310695 anti-SLC12A1 Abcam Cat#ab171747; RRID: AB_2802126 anti-CD31 R&D Systems Cat#bba7; RRID: AB_356960 anti-NPHS1 R&D Systems Cat#AF4269; RRID: AB_2154851 anti-CK8 Abcam Cat#ab9023; RRID: AB_306948 anti-Na/K/ATPase Abcam Cat#ab76020; RRID: AB_1310695 anti-HAVCR1 R&D Systems Cat#AF1750; RRID: AB_2116561 anti-SOX9 Abcam Cat#ab185230; RRID: AB_2715497 anti-NGAL Abcam Cat#ab23477; RRID: AB_447460 anti-KRT7 Abcam Cat#ab9021; RRID: AB_306947 anti-UPK2 Novus Biologicals Cat#NBP2-33389 Secondary antibodies included FITC-, Cy3, or Cy5-conjugated Jackson ImmunoResearch Cat#711-095-152; RRID: AB_2315776, Cat#712-095-153; RRID: AB_2340652, Cat#715-165-151; RRID: AB_2315777, Cat#713-165-147; RRID: AB_2315778, Cat#016-600-084; RRID: AB_2341101, Cat#703-165-155; RRID: AB_2340363 Secondary antibodies included AlexaFlour488-, or AlexaFlour568conjugated Thermo Fisher Scientific Cat#A21206; RRID: AB_2535792, Cat#A21202; RRID: AB_141607, Cat#A11057; RRID: AB_142581 anti-HOXD11 Millipore Sigma Cat#SAB1403944; RRID: AB_10739483 anti-GATA3 R&D Systems Cat#AF2605; RRID: AB_2108571 Chemicals, Peptides, and Recombinant Proteins StemFlex Medium Thermo Fisher Scientific Cat#A3349401 Stemdiff APEL2 Medium STEMCELL Technologies Cat#05275 Protein Free Hybridoma Medium II Thermo Fisher Scientific Cat#12040077 Matrigel hESC-Qualified Matrix Corning Cat#354277 CHIR99021 Tocris Bioscience Cat#4423 FGF9 R&D Systems Cat273-F9-025/CF Heparin Millipore Sigma Cat#H4784 Activin A R&D Systems Cat#338-AC Bmp4 R&D Systems Cat#314-BP Retinoic acid Millipore Sigma Cat#R2625 LDN193189 Axon Medchem Cat#Azon1509 GDNF R&D Systems Cat#212-GD (Continued on next page) e1 Cell Reports 33, 108514, December 15, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER EGF Thermo Fisher Scientific Cat#PHG0311 Aldosterone Millipore Sigma Cat#A9477 AVP Millipore Sigma Cat#V9879 K-252a Millipore Sigma Cat#K1639 ReLeSR STEMCELL Technologies Cat#05872 0.25% Trypsin-EDTA Thermo Fisher Scientific Cat#25200-114 Antibiotic-Antimycotic Thermo Fisher Scientific Cat#15240-062 Cisplatin Millipore Sigma Cat#P4394 Forskorin Selleck Chemicals Cat#S2449 Phalloidin-FITC Millipore Sigma Cat#P5282 DAPI (4’,6’- diamidino-2-phenylindole) Thermo Fisher Scientific Cat#D1306 Critical Commercial Assays Chromium Single Cell 5¿ Library &Gel Bead Kit 10x Genomics Cat#PN-1000006 Deposited Data Kidney organoid scRNA-seq This study GEO:GSE131086 Experimental Models: Cell Lines Human iPSCs: BJFF.6 line GEiC N/A Human ESCs: H9 line GEiC N/A Oligonucleotides All qPCR oligos This study Table S3 Software and Algorithms CellRanger 10x Genomics N/A Seurat https://satijalab.org/seurat/ N/A DoubletFinder https://github.com/chris-mcginnis-ucsf/ DoubletFinder N/A Harmony https://github.com/immunogenomics/ harmony N/A Monocle2 http://cole-trapnell-lab.github.io/ monocle-release/docs/ N/A scHCL https://github.com/ggjlab/scHCL/ N/A Other Fetal human kidney scRNA-seq Hochane et al., 2019 GEO:GSE114530 Adult human kidney scRNA-seq Wu et al., 2018 GEO:GSE118184

    Membrane:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Gel Extraction:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Plasmid Preparation:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    SYBR Green Assay:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Bicinchoninic Acid Protein Assay:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Polymerase Chain Reaction:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Reverse Transcription:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    RNA Sequencing:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025

    Control:

    Article Title: Hypoxia promotes airway differentiation in the human lung epithelium.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-rat Alexa Fluor 647 Jackson ImmunoResearch Cat# 712-605-153 Biological samples Fetal lung-derived organoid lines: HDBR 14580, 15909, 15917, 16186, 16197, 16217, 16393, 15328, 16392, 15350, 14489, 14710, 14731, 14556, 16402, 16587 HDBR London and Newcastle N/A Fetal lung-derived organoid lines: BRC 1915, 1943, 2315, 2316 Brain Repair Center, University of Cambridge N/A Adult lung-derived AT2 organoid lines: 847, 881, 887, 889, 890, 900 Cambridge Biorepository for Translational Medicine N/A Mouse embryonic lung epithelial progenitor organoids derived from wild-type C57BL/ 6J mice Charles River Laboratories N/A Chemicals, peptides, and recombinant proteins 2,20-Thiodiethanol (TDE) Merck Cat# 166782 PrimeSTAR GXL DNA Polymerase Takara Bio Europe Cat# R050A In-Fusion HD Cloning Plus Takara Bio Europe Cat# 638910 BbsI-HF New England BioLabs Cat# R3539S T4 DNA ligase New England BioLabs Cat# M0202S T4 Polynucleotide Kinase New England BioLabs Cat# M0201S Alkaline Phosphatase New England BioLabs Cat# M0290S Agarose Merck Cat# A5304 MultiScribe Reverse Transcriptase Thermo Fisher Scientific Cat# 4311235 Paraformaldehyde Sigma-Aldrich Cat# 158127-500G Bovine serum albumin Sigma-Aldrich Cat# A9647-100G Normal donkey serum Jackson ImmunoResearch Cat# 017.000.121 Optimum Cutting Temperature Tissue Tek Cat# 4583 Triton X-100 Sigma-Aldrich Cat# 1001246242 X100 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78440 RIPA buffer Merck Cat# R0278 Cell Recovery Solution Corning Cat# 354253 RBC lysis buffer BioLegend Cat# 420301 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 Collagenase Merck Cat# C9891 Trimethoprim Merck Cat# 92131 Doxycycline Merck Cat# D9891 DAPT Merck Cat# D5942 Dexamethasone Merck Cat# D4902 Y-27632 Merck Cat# 688000 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 8-Bromoadenosine 3′ 5′-cyclic monophosphate (cAMP) Merck Cat# B5386 N-acetylcysteine Merck Cat# A9165 N2 supplement Thermo Fisher Scientific Cat# 17502001 B27 supplement Thermo Fisher Scientific Cat# 12587001 EGF PeproTech Cat# AF-100-15 FGF10 PeproTech Cat# 100-26 FGF7 PeproTech Cat# 100-19 Noggin PeproTech Cat# 120-10C (Continued on next page) ll OPEN ACCESS Article e2 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER R-spondin Cambridge Stem Cell Institute N/A CHIR99021 Cambridge Stem Cell Institute N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 Advanced DMEM/F12 Thermo Fisher Scientific Cat# 12634-010 Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15140-122 Hepes Thermo Fisher Scientific Cat# 15630-056 GlutaMax Thermo Fisher Scientific Cat# 35050-038 N2 Thermo Fisher Scientific Cat# 17502-048 B27 Thermo Fisher Scientific Cat# 12587-010 Insulin-Transferrin-Selenium Thermo Fisher Scientific Cat# 41400-045 Fgf9 R&D Systems Cat# 7399-F9-025 Heparin Sigma-Aldrich Cat# H3149 BIRB796 Tocris Cat# 5989 Basement Membrane Extract Bio-Techne Cat# 3533-010-02 DMSO Sigma-Aldrich Cat# D2650 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 TrypLE Express Thermo Fisher Scientific Cat# 12605-010 Trypan Blue Solution Thermo Fisher Scientific Cat# 15250061 DreamTaq HS DNA Polymerase Thermo Fisher Scientific Cat# EP1703 Lenti-X Concentrator Takara Bio Europe Cat# 631232 CD326 (EpCAM) microbeads Miltenyi Biotec Cat# 130-061-101 Roxadustat (FG-4592) Selleckchem Cat# S1007 PT2385 Selleckchem Cat# S8352 Fluoromount Merck Cat# F4680 Critical commercial assays QIAprep Spin Miniprep Kit Qiagen Cat# 27104 Qiaquick Gel Extraction Kit Qiagen Cat# 28704 EndoFree Plasmid Maxi Kit Qiagen Cat# 12362 RNeasy Plus Mini Kit Qiagen Cat# 74134 RNase-Free DNase Set Qiagen Cat# 79254 PowerUp SYBR Green Master Mix Thermo Fisher Scientific Cat# A25741 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 Evercode Cell Fixation kit Parse Biosciences N/A Evercode Whole Transcriptome v2 kit Parse Biosciences N/A Evercode Whole Transcriptome v3 kit Parse Biosciences N/A Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32854 NEBNext Ultra II DNA Library Prep Kit New England BioLabs Cat# E7645S LookOut Mycoplasma PCR Detection Kit Merck Cat# MP0035 High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Deposited data Human lung epithelial progenitor organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE273089 HIF1a and HIF2a DamID-seq This paper GEO: GSE272859 Human lung epithelial progenitor organoids bulk RNA-seq for control and HIF1a CRISPRi This paper GEO: GSE272860 Human fetal lung-derived AT2 organoids scRNA-seq in normoxia and hypoxia This paper GEO: GSE296547 (Continued on next page) ll OPEN ACCESSArticle Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Spatial transcriptomic data of human fetal lungs by 10x Visium Sountoulidis et al.31 GEO: GSE215897 Spatial transcriptomic data of human fetal lungs by 10X Xenium Quach et al.33 GEO: GSE264425 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease Adams et al.47 GEO: GSE136831 Adult human lung scRNA-seq atlas of idiopathic pulmonary fibrosis Habermann et al.46 GEO: GSE135893 Human fetal lung scRNA-seq atlas He et al.8 ArrayExpress: E-MTAB-11278 Human fetal lung scATAC-seq data He et al.8 ArrayExpress: E-MTAB-11266 Oligonucleotides gRNA-HIF1A_1: GCTGGCCGAAGCGACGAAGA Horlbeck et al.43 N/A gRNA-HIF1A_2: GCCTCCTGTCCCCTCAGACG Horlbeck et al.43 N/A gRNA-HIF2A_1: GGAGGCGGCCGTACAATCCT Horlbeck et al.43 N/A gRNA-HIF2A_2: GGGCCGCCTCAGGAGCGCTG Horlbeck et al.43 N/A gRNA-KLF4_1: GCGCGGAGCTGCGAACTGGT Horlbeck et al.43 N/A gRNA-KLF4_2: GGACTGCACCGCCCAGACAT Horlbeck et al.43 N/A gRNA-KLF5_1: GCTCTCGCGGAGGTCGGCGG Horlbeck et al.43 N/A gRNA-KLF5_2: GGTTCTCTCGCGGAGGTCGG Horlbeck et al.43 N/A Recombinant DNA pLenti-tetON-KRAB-dCas9-DHFREF1aTagRFP-2A-tet3G Sun et al.42 Addgene: #167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.42 Addgene: #167936 HRE-ODD-GFP reporter Ortmann et al.39 N/A pLenti-hSPC-eGFP-EF1a-TagRFP Lim et al.9 Addgene: #201681 SFFV-mNeonGreen-Dam Sun et al.28 N/A SFFV-mNeonGreen-Dam-HIF1A This paper N/A SFFV-mNeonGreen-Dam-HIF2A This paper N/A pLenti-tetON-HIF1A-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-HIF2A-EF1a-TagRFP2A-tet3G This paper N/A Software and algorithms nf-core/rnaseq pipeline v3.9 Ewels et al.59 https://github.com/nf-core/rnaseq DESeq2 Love et al.60 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Gene Set Enrichment Analysis Subramanian et al.29 https://www.gsea-msigdb.org/gsea/ index.jsp split-pipe v1.1.1 Parse Biosciences N/A split-pipe v1.5.0 Parse Biosciences N/A Seurat v5 Hao et al.61 https://satijalab.org/seurat/ Monocle 3 Cao et al.38 https://cole-trapnell-lab.github.io/ monocle3/ (Continued on next page) ll OPEN ACCESS Article e4 Cell Stem Cell 32, 1–18.e1–e9, November 6, 2025



    Similar Products

    93
    R&D Systems fgf9 r d systems
    Fgf9 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Mouse+FGF-9+Protein/pm41075787-319-68-69
    Average 93 stars, based on 1 article reviews
    fgf9 r d systems - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    95
    R&D Systems recombinant fgf9 r d systems 273 f9 025 transferrin roche 652202 xx
    Recombinant Fgf9 R D Systems 273 F9 025 Transferrin Roche 652202 Xx, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Human+FGF-9+Protein/us12018286-125-81-83
    Average 95 stars, based on 1 article reviews
    recombinant fgf9 r d systems 273 f9 025 transferrin roche 652202 xx - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    R&D Systems vol vol fgf9 r d systems 273 f9
    Vol Vol Fgf9 R D Systems 273 F9, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Human+FGF-9+Protein/pmc11154671-596-29-31
    Average 95 stars, based on 1 article reviews
    vol vol fgf9 r d systems 273 f9 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    R&D Systems recombinant protein fgf9 r d systems 273 f9
    Recombinant Protein Fgf9 R D Systems 273 F9, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Human+FGF-9+Protein/10__7554_slash_elife__88144__4-338-151-154
    Average 95 stars, based on 1 article reviews
    recombinant protein fgf9 r d systems 273 f9 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    R&D Systems recombinant proteins human recombinant fgf9 r d systems
    Recombinant Proteins Human Recombinant Fgf9 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Human+FGF-9+Protein/pm34847364-327-251-256
    Average 95 stars, based on 1 article reviews
    recombinant proteins human recombinant fgf9 r d systems - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    93
    R&D Systems af 251 na anti fgf9 neutralizing antibody r d system
    Af 251 Na Anti Fgf9 Neutralizing Antibody R D System, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Human+KGF%2FFGF-7+Antibody/pm34624218-296-53-57
    Average 93 stars, based on 1 article reviews
    af 251 na anti fgf9 neutralizing antibody r d system - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    95
    R&D Systems 1x fgf9 r d systems 273 f9 025
    1x Fgf9 R D Systems 273 F9 025, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fgf9+r+d+systems/Recombinant+Human+FGF-9+Protein/pmc08206157__41467_2021_23911_MOESM1_ESM-104-34-36
    Average 95 stars, based on 1 article reviews
    1x fgf9 r d systems 273 f9 025 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results